I'm trying to find a way to load FunCapctha in simple html file. I have the sitekey to provide, just can't find the proper html/js code to do it. I've come acro
Can anyone please help me create or point me in the right direction to get the following SOAP header using PHP classes? 🙏 <SOAP-ENV:Header xmlns:wsa=
I have a side navigation view using NavigationView with side bar menu. In Portrait mode, I have a back button with the title "Menu". In Landscape mode, I have a
I have 2 strings. The first string is a primer which contains "ATTACATGGTTTACAACTTT" The second string contains my reverse sequence in a dictionary which is: }"
Context Most Haskell tutorials I know (e.g. LYAH) introduce newtypes as a cost-free idiom that allows enforcing more type safety. For instance, this code will
I have a fetch request as below; fetch(url, { mode: 'no-cors', credentials: 'include' }).then((response) => { if (response.ok) { return;
I have class member which is either None or a dict. I have a method for the lengths of that member that returns None if the member is None or the size of the di
I have a problem understanding how to create a grid component, which has in input of a number of columns, rows and a list of strings for the inside element of g
How can I list all tags of a Docker image on a remote Docker registry using the CLI (preferred) or curl? Preferably without pulling all versions from the remot